FWGE , a fermented wheat germ extract, has been applied in the supplementary therapy of human cancers. Because tamoxifen is commonly used in the therapy of ER
breast cancer, in this study the combined effect of tamoxifen and FWGE treatment was investigated on MCF-7 breast cancer cells, in order to detect a possible agonistic or antagonistic action. Cytotoxicity was measured by MTT assay, the percentage of mitoses and apoptotic cells was determined morphologically, apoptosis and S-phase was measured by flow cytometry, and estrogen-receptor activity was determined by semiquantitative measurement of the estrogen-responsive pS2 gene mRNA production. Tamoxifen (1 nM) alone had no effect on the percentage of the apoptotic cell fraction and significantly reduced the percentage of the S-phase, compared to untreated cells. FWGE (625
g/mL) significantly increased apoptosis after 48 hours of treatment. Tamoxifen together with FWGE significantly increased apoptosis already 24 hours after starting treatment but had only a slight (not significant) effect on mitosis and S-phase. Estrogen-receptor activity of MCF-7 cells was enhanced by FWGE , decreased by tamoxifen, and was further decreased by combined tamoxifen and FWGE treatment. As apoptosis increased when FWGE was added to tamoxifen treatment, the use of supplementary therapy with FWGE in the case of ER
breast tumors may enhance the therapeutic effects of tamoxifen.

MATERIALS AND METHODS Chemicals MTT reagent, oligo-dT12–18 primers, deoxyribonucleoside triphosphates, propidium iodide, ethidium bromide, and agarose were purchased from Sigma (St. Louis, MO); fetal calf serum came from GIBCO (Invitrogen Life Technologies, Paisley, Scotland); tamoxifen citrate (Z-1-{p-dimethylaminoethoxyphenyl}-1,2-diphenyl-1-butene) was the product of TEVA Pharmaceutical Industries, Ltd. (Israel). From FWGE , provided by Biromedicina Co. (Budapest, Hungary), a 10-mg/mL stock solution was dissolved in Dulbecco’s modified Eagle’s medium (DMEM), filter sterilized, and serial dilutions were made. Cell Cultures MCF-7 (ECACC 86012803) and MDA-MB-231 (ECACC 92020424) human breast adenocarcinoma cells, and MRC-5 (ECACC 84101801) human fetal lung cells were purchased from ECACC (European Collection of Cell Cultures, UK), HepG2 (ATCC HB-8065) from ATCC (American Type Culture Collection), and was cultured in DMEM without phenol red (GIBCO; Meckenheim, Germany), using plastic culture dishes, microwell plates, and thermanox coverslips (Nunc A/S; Roskilde, Denmark). DMEM medium was supplemented with 10% (v/v) heatinactivated fetal calf serum (FCS), 2 mM L-glutamin, and antibiotics: 100 units/mL penicillin and 100
g/mL streptomycin (Sigma, St. Louis, MO). Cells growing as a monolayer were kept in an isolated 37°C, 5% CO2 thermostat. For the study of cell death and cell cycle, the cells were seeded into 6-well plates at 5 105 cells/well density; for the MTT assay, 96-well microplates were used with 2 103 cells/well. 10-cm dishes in triplicate were used to grow cells to isolate RNA. 

Treatment Cytotoxicity testing of FWGE (at 24 hours) was performed in the concentration range of 156
g/mL and 5 mg/mL using 2 estrogen receptor (ER)-positive (MCF-7 and HepG2) and two ERnegative (MRC5 and MDA) cell lines. The highest noncytotoxic dose (625
g/mL) was used in the experiments. FWGE , tamoxifen, and 17 -estradiol were administered to MCF-7 cell cultures 24 hours after plating, while control cultures were maintained in DMEM. Four (4) samples of cells were cultured and treated in a volume of 100
L in 96-well tissue culture plates for a further 24 and 48 hours for apoptosis and cell-cycle studies, as well as for the MTT assay and for estrogenreceptor activity measurements. The following treatment schedule was applied. Group 1: Control (DMEM); Group 2: FWGE (625
g/mL); Group 3: tamoxifen (1 nM); Group 4: tamoxifen (1 nM)
FWGE (625
g/mL). MTT Assay Cytotoxic effects on the growth and viability of 2 104 cells/mL were determined in 96-microwell plates using tetrazolium dye MTT (3[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay, as described.15 Optical density (O.D.) of the wells was determined using an Anthos 2020 (Salzburg, Austria) enzyme-linked immunosorbent assay (ELISA) microplate reader at a test wavelength of 570 nm and a reference wavelength of 690 nm. All experiments were performed at least 3 times, with 4 wells for each concentration of the tested agents. The control cells were grown under the same conditions without the addition of the test compounds. Cell survival (% of control) was calculated relative to untreated controls. 

Flow Cytometry MCF-7 cells were cultured in 10-cm dishes at an initial plating density of 5 105 cells/dish in DMEM containing 10% FCS and antibiotics for 24 hours. At hour 24, the cells were treated similarly, as described above for 24 and 48 hours. Pulse labeling of cells with 5
g/mL 5-bromo2-deoxyuridine (BrdU, Sigma, St. Louis, MO) was performed 2 hours prior to termination of the cultures. DNA was stained with propidium iodide (PI), and the incorporated BrdU was detected immuncytochemically with the FITC-labeled monoclonal antibody (Beckton-Dickinson), as described by others.16 Flow-cytometry analysis was performed in a FACS-Calibur (Beckton-Dickinson) flow cytometer at a flow rate of approximately 400 cells/sec. CellQuest software (Beckton-Dickinson) was used for the analysis of the obtained data. The percentages of S-phase and apoptotic fractions were determined on the basis of PI and anti-BrdU-FITC/PI fluorescence. Morphological Detection of Apoptosis and Mitosis MCF-7 human breast cancer cells were plated on glass coverslips in plastic dishes (diameter, 35 mm) at a density of 1.25 104 cells/cm2 treated as described above. The coverslip preparates were fixed in methanol: acetic acid (3:1) mixture for 5 minutes and stained with haematoxylin and eosin. The criteria described by Wyllie et al.17 and Bursch et al.18 were applied. Apoptotic and mitotic forms among 200 cells were counted and the values (apoptotic and mitotic index) were expressed as a percentage. 

Semiquantitative PCR Protocol RNA was isolated from cell cultures using the GenElute total RNA isolation kit (Sigma, RTN 70) following the manufacturer’s instructions. Reverse transcription was performed in 20-
l reaction volumes using 1
l of isolated total RNA, 0.1
g oligo-dT12–18 primers, 15
M each deoxyribonucleoside triphosphates, buffer (shipped with enzyme) and 200 U of M-MLV reverse transcriptase (GIBCO-BRL, Invitrogen Life Technologies, Paisley, Scotland) at 37°C for 90 minutes. The reaction was stopped in boiling water for 5 minutes, and the synthetized first strand cDNA was stored at 80°C. Estrogen-receptor activity was monitored by the trefoil factor (pS2) transcript formation. The pS2 gene has an estrogen-responsive element (ERE) in its promoter, so the amount of transcribed pS2 mRNA is proportional to the activity of ER.19,20 In the PCR reactions, parallel amplification of 18S ribosomal RNA (rRNA) was performed as an internal control.21 The pS2-specific primers used were 5CATGGAGAACAAGGTGATCTG and 5CAGAAGCGTGTCTGAGGTGTC amplifying 336 bp DNA20 and 18S-rRNA primers were 5GTAACCCGTTGAACCCCATT 3 and 5CCATCCAATCGGTAGTAGCG 3 producing 151 bp PCR fragment. Primers were synthesized by the Genodia Co. (Budapest, Hungary). The 20-
l PCR reaction volumes contained 1
L 1st strand cDNA, 15
M of each primers, 15
M of each dNTP, 2.5 mM MgCl2, 1 buffer, and 0.5 U RedTaq DNA polymerase (Sigma, St. Louis, MO). PCR reactions were performed in a Techne Progene thermocycler (Cambridge, U.K.). Samples were heated to 94°C for 3 minutes, annealed at 50°C for 1 minute, and DNA was synthesized at 72°C for 10 minutes. 

30 cycles of amplification was performed: 94°C for 30 seconds, 50°C for 45 seconds, 72°C for 40 seconds, and last extension at 72°C for 10 minutes. 10
L of PCR products were analyzed on 2% agarose TBE gels containing ethidium bromide. Gels were analyzed by the Kodak EDAS 290/1Dgel system (Eastman Kodak Co., Rochester, NY) and band intensities were evaluated as relative intensity values to the 18S rRNA PCR product and expressed as a percent of control. Statistical Analysis Statistical analyses were performed with a Student’s paired t test. P values of 0.05 were considered to be significant.RESULTS Cytotoxicity (MTT Assay) FWGE exhibited cytotoxicity only in the concentration range over 1.250–2.500
g/mL on the cell lines used, as shown in Fig. 1. At lower concentrations both ER
cell lines (MCF-7 and HepG2) responded with viability increase to FWGE treatment, while ER-cells (MDA-MB231 and MRC5) did not. The relative optical densities in MTT assays obtained after 24 and 48 hours treatment of MCF7 cells with the various substances are shown in Fig. 2. Tamoxifen exhibited a slight decrease relative to the control values at both time points. A statistically significant (p  0.02) increase was found at 24 and 48 hours, respectively, after FWGE  treatment, and the same phenomenon appeared with FWGE plus tamoxifen. Flow Cytometry Analysis FWGE markedly enhanced apoptosis of MCF7 cells after 24 hours of the treatment, followed by a further increase at the 48th hour. Tamoxifen alone slightly decreased apoptosis at the 24th hour, and this decrease remained unchanged after 48 hours. On the other hand, the combined treatment of the cell cultures with tamoxifen and FWGE markedly enhanced apoptosis at all time points of the experiments (Fig. 3A).

 An elevation of the percentage of cells in the S phase was observed at 24 hours of the FWGE treatment, which was followed by a decrease at the 48th hour, when S-phase ratios became similar to the control values. On the other hand, tamoxifen markedly decreased the ratio of cells in the S phase at the 48th hour of the treatment. FWGE combined with tamoxifen had no influence on the inhibitory effect of tamoxifen alone on the S-phase ratio (Fig. 3B). Morphological Studies The ratios of apoptotic and mitotic MCF-7 cells in the control and in the treated cultures are shown in Fig. 3C and Fig. 3D. The results of apoptotic activity correspond—with slight differences—to those obtained by flow cytometry. Regarding apoptosis, both FWGE and FWGE plus tamoxifen treatment induced a higher ratio of apoptosis in comparison to the controls. Mitotic activity was decreased by tamoxifen and, to some extent, by FWGE , compared to the controls. FWGE plus tamoxifen treatment resulted in very low mitotic activity at 24 and 48 hours. Estrogen-Receptor Activity Estrogen-receptor activities of MCF-7 cells treated for 24 and 48 hours with various substances are shown in Figs. 4A–B. Both estrogen and FWGE increased the transcriptional activity of ER at 48 hours. The values obtained by tamoxifen treatment at any time point were essentially lower, compared to the controls. The cell culture treated with FWGE plus tamoxifen showed no significant decrease at 24 hours and significant decrease at hour 48, compared to the controls. No significant difference could be detected between tamoxifen and FWGE plus tamoxifen-treated cells at 24 or 48 hours, respectively.

The combination of tamoxifen and FWGE resulted in nearly the same effect, as observed after FWGE treatment alone. The effect of tamoxifen on estrogen receptor–positive breast carcinoma cultures has been widely studied.5,22 The type of programmed cell death caused by tamoxifen is predominantly apoptosis, but in cultures cytoplasmic vacuolar cell death has also been shown.18,23 In our study, in accordance with the literature,24,25 decreased proliferative activity occurred in an earlier period (at 24 hours), and apoptosis could be observed later (at 72 hours). The mode of action of FWGE regarding in vivo retardation of tumor progression is based on its specific metabolic effects in cancer cells and on its apoptotic induction activity. FWGE inhibits glycolysis and pentose cycle enzymes in cancer cells, and induces apoptosis through caspase-3-mediated poly(ADP ribose)polymerase cleavage.11 In our study, the apoptosis-inducing effect of FWGE became evident in breast cancer cell lines, too. When, in the mentioned cancer cells, the fermented wheat germ extract was applied in combination with tamoxifen, this phenomenon, together with the normalization of the expression of estrogen receptors, was reinforced. CONCLUSION In conclusion, the medical nutriment, FWGE , enhances the efficacy of tamoxifen in estrogen receptor–positive breast cancer and, thus, may be recommended as a supportive aid during tamoxifen treatment of such tumors.